Celastrol augments sensitivity of NLRP3 to CP-456773 by modulating HSP-90 and inducing autophagy in dextran sodium sulphate-induced colitis in rats
Sameh Saber, Eman M. Abd El-Kader, Hossam Sharaf, Rewan El-Shamy, Baraah El-Saeed, Asmaa Mostafa, Dalia Ezzat, Ahmed Shata
PII: S0041-008X(20)30199-X
DOI: https://doi.org/10.1016/j.taap.2020.115075
Reference: YTAAP 115075
To appear in: Toxicology and Applied Pharmacology
Received date: 18 March 2020
Revised date: 7 May 2020
Accepted date: 25 May 2020
Please cite this article as: S. Saber, E.M. Abd El-Kader, H. Sharaf, et al., Celastrol augments sensitivity of NLRP3 to CP-456773 by modulating HSP-90 and inducing autophagy in dextran sodium sulphate-induced colitis in rats, Toxicology and Applied Pharmacology (2020), https://doi.org/10.1016/j.taap.2020.115075
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier.
Celastrol augments sensitivity of NLRP3 to CP-456773 by modulating HSP-90 and inducing autophagy in dextran sodium sulphate-induced colitis in rats
Sameh Sabera,* [email protected], Eman M. Abd El-Kadera, Hossam Sharaf d,
Rewan El-Shamyb, Baraah El-Saeedb, Asmaa Mostafab, Dalia Ezzatb, Ahmed Shatac,d
aDepartment of Pharmacology, Faculty of Pharmacy, Delta University for Science and Technology, Gamasa, Egypt.
bDepartment of Biochemistry, Faculty of Pharmacy, Delta University for Science and
Technology, Gamasa, Egypt.
cDepartment of Clinical pharmacology, Faculty of Medicine, Mansoura University, Mansoura, Egypt.
dDepartment of Clinical Pharmacy, Faculty of Pharmacy, Delta University for Science and Technology, Gamasa, Egypt.
*Corresponding author at: Department of Pharmacology, Faculty of Pharmacy, Delta University for Science and Technology, Costal international road in front of industrial area. Gamasa, Manasoura, Dakahlia, Egypt.
Abstract
NLRP3, one of the HSP-90 clients, has been defined as a critical component of IBD. In a rat model of DSS-induced colitis, we investigated the anti-inflammatory potential of the combined therapy with CP-456773 (CP), an NLRP3 inhibitor, and celastrol (CSR), an NF-κB inhibitor. Our results revealed that the CSR/CP combined therapy (CCCT) attenuated colon shortening, DAI and MDI in addition to improvement of the colonic histological picture. Moreover, the CCCT increased the antioxidant defense machinery of the colonic tissue and decreased MPO activity. Furthermore, the inflammation markers such as TNF-α and IL-6 were downregulated. These effects might be attributed to the inhibitory effect of CSR on the priming step of the NLRP3 inflammasome activation by interrupting NF-κB signal ing and inhibition of HSP-90 (at the protein and mRNA levels) along with inhibitory effect of CP on the expression of the NLRP3. These latter effects resulted in decreased tissue expression and activity of the caspase-1 and repressing the subsequent release of the active forms of IL-1β and IL-18, hence, the pyroptosis process is restrained. Additionally, the CCCT resulted in inducing autophagy by AMPK/mTOR-dependent mechanisms leading to the accumulation of BECN1 protein and a significant decrease in the levels of p62 SQSTM1. The inhibitory effect on HSP-90 in conjunction with induction of autophagy suggest increased autophagic degradation of NLRP3. This novel approach provides a basis for the clinical application of this combination in IBD treatment and might also be promising for the pharmacological intervention of other NLRP3 inflammasome-dependent inflammatory conditions.
Keywords: celastrol; CP-456773/MCC950; HSP-90; NLRP3 inflammasome; autophagy; colitis
Abbreviations
AMPK AMP-activated protein kinase
ASC adaptor protein apoptosis-associated speck- like protein containing CARD
DAI disease activity index
DAMPs danger-associated molecular patterns
GSH reduced glutathione
HSP-90 heat shock protein 90
IBD inflammatory bowel disease
MDA malondialdehyde
MDI macroscopic damage index
mTOR mammalian target of rapamycin
NFκB Nuclear transcription factor kappa B
NLRP3 Nod-like receptor protein 3
PAMPs pathogen-associated molecular patterns
SGT1 ubiquitin ligase-associated protein
TLR Toll like receptor;
TNF-α tumor necrosis factor-alpha
⦁ Introduction
Ulcerative colitis, an inflammatory bowel disease (IBD), is a recurrent inflammatory condition that results in ulcers affecting the colon and rectum. Inflammasomes have recently been recognized as key components of IBDs. Considering its contributing role in activating inflammatory cascades, inflammasome inhibitors would have a promising future in the development of novel approaches for IBDs treatment. In response to danger-associated molecular patterns (DAMPs) or pathogen-associated molecular patterns (PAMPs), inflammasomes orchestrate immune responses by activating caspase-1 leading to the production of IL-1β and IL-18. As a result, inflammasomes initiate the programmed cell death process known as pyroptosis (Saber et al., 2020). NLRP3 is a pattern recognition
receptor that becomes activated in a two-step process. Toll-like receptors (TLRs), nucleotide- binding oligomerization domain-like receptors (NOD) or cytokine receptor activation stimulate NF-κB signalling to initiate innate immune responses as a priming step in the canonical inflammasome activation. The activation of NF-κB induces the mRNA and protein expression of NLRP3, pro-IL-1β and pro-IL-18. The second step which is activated by diverse stimuli such as danger signals of both endogenous and exogenous origin leads to the oligomerization of NLRP3 and the recruitment of the adaptor protein apoptosis-associated speck-like protein containing CARD (ASC) and procaspase-1 into the complex [17]. When procaspase-1 is associated with NLRPs and ASC, the inflammasome complex promotes autocatalytic cleavage of procaspase-1, forming the active form of the caspase-1 enzyme. Then, active caspase-1 promotes the catalytic cleavage of the proforms of IL-1β and IL-18 into their mature forms.
NLRP3 has been recognized as one of the heat shock protein 90 (HSP-90) clients. HSP-90 is a molecular chaperone that regulates the maturation, stability and folding of several substrate proteins (clients). HSP-90 forms a complex with NLRP3 and retains the NLRP3 competent for activation after reception of the priming signal. Otherwise, inhibiting HSP-90 from complexing with NLRP3 will subject the receptor protein to degradation by autophagy. In other words, NLRP3 is removed from the cell unless protected by a protein complex containing HSP-90. In this regard, autophagy represents an ultimate cellular degradation system for inflammasomes components. Therefore, HSP-90 inhibitors might pose an interesting challenge in inhibiting inflammasome activation in a variety of inflammatory diseases.
Autophagy is a cellular recycling and control system that facilitates the turnover of damaged proteins and organelles during inflammation and immune responses. Emerging evidence suggests that autophagy dysfunction is associated with inflammatory bowel disorders.
Deletion of autophagy-associated genes is associated with increased caspase-1 activity and IL-1β secretion. In this regard, a crosstalk evidently exists between inflammasomes activation and autophagy. In contrast, apoptosis and pyroptosis, the other two forms of programmed cell death, have been implicated in the pathogenesis and progression of IBDs.
The natural triterpene, celastrol exhibited potent anti-inflammatory activities in a multitude of experimental models by interrupting NF-κB signal ing leading to downregulation of proinflammatory cytokine production including IL-1β. Although celastrol showed promise in the treatment of various inflammatory conditions, the mechanisms underlying the anti- inflammatory effects are not fully understood. In addition, experimental evidence that celastrol can affect the crosstalk between inflammasome activation and autophagy is still lacking. Moreover, yet, it is not understood whether autophagy signalling contributes to the celastrol-mediated anti-inflammatory activity.
CP-456773 (CP)/MCC950/CRID3 is a potent small molecule inhibitor of canonical and non- canonical NLRP3 activation. CP has been examined in various NLRP3 driven inflammatory conditions. Using a spontaneous chronic colitis mouse model Winnie, Perera et al. (2018) illustrated the efficacy of CP in the treatment of murine ulcerative colitis. Lately, CP was suggested as an ideal therapeutic option for the selective inhibition of NLRP3 in colitis (Agampodi Promoda et al., 2017). The exact mechanism by which CP exerts its NLRP3 inhibiting activity is still obscure. Despite this, CP was not effective against an NLRP1 mutant emphasizing the specificity in vivo. CP did not affect K+ efflux, Ca2+ flux, NLRP3- NLRP3 or NLRP3-ASC interactions. Another report dismissed other probable targets of CP such as GST omega 1-125, SUR1, SUR2a and SUR2b. Furthermore, CP did not target caspase-1, SYK, JNK, GPR40, and GPR12024 which are all implicated in the activation process of NLRP3(Coll et al., 2015).
Herein, we aimed at investigating the therapeutic benefits of the simultaneous administration of CSR with CP on the dextran sodium sulphate (DSS) colitis rat model. We were interested in exploring the effects of CSR and CP on the potential interplay between HSP-90, NLRP3 inflammasome activation and autophagy induction during the course of ulcerative colitis. The administration of DSS is toxic to colonic epithelial cells leading to compromised mucosal barrier functions. As a result, a human ulcerative colitis-like pathology is produced. Moreover, the DSS-induced colitis model is rapid, reproducible and controllable.
⦁ Materials and methods
⦁ Animals
Adult male Sprague Dawley rats weighing 280 ± 20 g were purchased from the animal facility at the Faculty of Pharmacy, Delta University for Science and Technology (FPDUST), Gamasa, Egypt. Rats were fed pathogen-free standard diet and permitted water ad libitum. Animals were maintained under standard conditions of (21°C, 45-55% humidity) and light/dark cycles (12/12 h). A Two-week acclimatization period was permitted before starting experimental work. Protocols and experimental procedures were approved by the IACUC at the FPDUST, Approval number (FPDU632020). In addition, all experimental procedures comply with the ARRIVE guidelines from the (NC3Rs) and carried out in accordance with the EU Directive 2010/63/EU for animal experiments.
⦁ Induction of acute colitis
Acute colitis was induced by allowing rats ad libitum access to 4% w/v DSS (molecular weight= 30-40 kDa) in pathogen-free water. Seven days later, the administration of DSS was discontinued. Then, the rats were sacrificed at the 15th day after induction. Animals were administered CSR or CP orally starting 2 days before induction of colitis (Saber et al., 2019a). Body weight, stool consistency and gross bleeding were recorded daily.
⦁ Experimental design
Rats were randomly allocated to seven groups as follows: N group (n = 6), rats were administered no treatment from day 1 to day 16; CSR group (n = 6), rats were administered CSR (1 mg/kg/day, p.o.) from day 1 to day 16; CP group (n = 6), rats were administered CP (20 mg/kg/day, p.o.) from day 1 to day 16; UC group (n = 10), rats were allowed ad libitum access to drinking water containing 4% DSS (w/v) from day 3 to day 9; UC/CSR group (n = 8), rats received CSR (1 mg/kg/day, p.o.) from day 1 to day 16 and were allowed ad libitum access to drinking water containing 4% DSS (w/v) from day 3 to day 9; UC/CP group (n = 8), rats received CP (20 mg/kg/day, p.o.) from day 1 to day 16 and were allowed ad libitum access to drinking water containing 4% DSS (w/v) from day 3 to day 9; UC/CSR/CP group (n = 8), rats received CSR (1 mg/kg/day, p.o.) + CP (20 mg/kg/day, p.o.) from day 1 to day 16 and were allowed ad libitum access to drinking water containing 4% DSS (w/v) from day 3 to day 9. At the end of experiment, rats were euthanized 24 h after the last administered drug doses.
⦁ Calculation of the disease activity index (DAI)
DAI is a clinical evaluation of the intensity of intestinal injury due to the effect of DSS. DAI is presented quantitatively as a collective score based on the reduction in body weight, stool consistency and gross bleeding (Cooper et al., 1993). Clinical evaluation and scoring was performed by a blinded practitioner of sufficient experience in the field of gastroenterology.
⦁ Calculation of the macroscopic damage index (MDI)
Portions of colons were excised, collected and rinsed with chilled PBS. In a single-blinded technique, a second scoring system was applied to visually evaluate the macroscopic damage along colons (Jagtap et al., 2004). The MDI is based on an arbitrary scale ranging from 0 to
4. After macroscopic evaluation, sections of the distal colons were preserved quickly in
RNAlater (Qiagen, Netherlands, Germany) (10% w/v) for subsequent RNA extraction, while some other sections were used for histological and biochemical investigations.
⦁ Histological assessment of colitis
Colon tissue specimens were isolated from different animal groups, fixed in 4% neutral buffered formalin for 24 h and embedded in paraffin. Four μm-thick sections from the paraffin blocks were processed. Standard histology protocol was sequentially performed by a blinded histologist to stain colon sections with haematoxylin and eosin (H&E). A scoring system was used as previously described by Saber et al. (2019a) to assess lesions along the entire colon length. Colon sections were examined by a digital camera mounted on a BX51 Olympus optical microscope (Olympus Corporation, Tokyo, Japan).
⦁ Determination of MPO, GSH, SOD and MDA
A kit obtained from Sigma-Aldrich (St. Louis, MO, USA) was used in the assessment of MPO in colon tissue homogenate using the buffer provided in the kit. GSH, SOD and MDA were measured spectrophotometrically in colon tissue homogenate using commercial kits obtained from Biodiagnostics (Cairo, Egypt). All procedures were followed the manufacturer’s protocol.
⦁ Determination of caspase-1 activity
A caspase-1 colorimetric assay kit was purchased from R&D Systems (Minneapolis, MN, USA). Spectrophotometric determination of caspase-1 activity is based on the detection at 405 nm of the cleaved p-nitroanilide (p-NA) chromophore. The results are presented as the fold change in caspase-1 activity relative to the N group.
⦁ Immunohistochemical staining of caspase-1
Immunohistochemical labelling of caspase-1 was performed according to the methods previously described by Saber et al. (2019b). Tissues from paraffin blocks were deparaffinized, hydrated, immersed in an antigen retrieval solution (EDTA, pH 8), and treated with hydrogen peroxide (0.3%) followed by a protein block step. Colon sections were incubated overnight with mouse monoclonal caspase-1 primary antibody (14F468) (Novus Biologicals, LLC 10730 E. Briarwood Avenue, Building IV Centennial CO 80112, USA; 1:100 dilution). Then sections were rinsed three times with PBS, incubated with anti-mouse IgG secondary antibodies (EnVision+™ System HRP; Dako) for 30 min at room temperature, visualized with di-aminobenzidine commercial kits (Liquid DAB+Substrate Chromogen System; Dako), and finally counterstained with Mayer’s hematoxylin. As a negative control procedure, the primary antibody was replaced by normal mouse serum. Ten different high power fields (HPF) were examined microscopically to detect the expression level of caspase-1 which is calculated as the number of positive cells per total 1000 counted cells and presented as fold change versus N group.
⦁ Determination of TNF-α, IL-6, IL-1β, and IL-18
In accordance with the given instructions, ELISA kits obtained from R&D systems were used for the measurment of TNF-α and IL-6 in colon tissue homogenate. IL-1β was determined using kits purchased from BioLegend (San Diego, CA, USA), and IL-18 was determined using kits purchased from USCN Life Science Inc. (Wuhan, China).
⦁ Determination of serum level of HSP-90
ELISA kit supplied by CUSABIO (Wuhan, China) was used for the determination of HSP-90 as instructed.
⦁ Determination of p-AMPKα (Ser487)/AMPKα, p-mTOR (Ser2448), BECN1 and p62 SQSTMI
p-AMPKα (Ser487) and total AMPKα levels were measured by ELISA kits supplied by RayBiotech (Norcross, GA). Levels of p-AMPKα (Ser487) were normalized to the level of total AMPKα protein measured in the same sample. Levels of p-mTOR (Ser2448) were assayed by ELISA using kits supplied by Abcam (Cambridge, UK), the results were normalized to the total protein content determined by BCA protein assay reagent kit obtained from Thermo Fisher Scientific Inc. (Rockford, USA). BECN1 and p62 SQSTMI colon tissue levels were determined using ELISA kits supplied by CUSABIO and MyBioSource (CA, USA). Al protocols followed the manufacturer’s instructions.
⦁ qRT-PCR analysis for the mRNA expression of HSP-90 and NLRP3
Distal colon sections kept in RNAlater (Qiagen, Germany) was used for the extraction of total RNA with an RNeasy Mini kit supplied by Qiagen (Hilden, Germany) in an RNase-free environment as per the manufacturer’s instructions. RNA concentration and purity were determined spectrophotometrical y (260 nm) using a Nano Drop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RNA (2 µg) was reverse transcribed into complementary DNA (cDNA) by Quantiscript reverse transcriptase Kit (Qiagen) in a reaction volume of 20 µL. A Rotor Gene Q thermocycler (Qiagen) and SYBR Green PCR Master Mix (Qiagen) were used for the quantitative reverse‐ transcription polymerase chain reaction (PCR). Expression levels were normalized to GAPDH as the invariant endogenous control in the same sample. The sequences of the PCR primer pairs used in the quantitative reverse‐ transcription PCR are shown in Table 1. The relative gene expression was assessed by the comparative cycle threshold (Ct) (2−ΔΔCT) method.
⦁ Statistical analysis
Statistical analysis was performed using GraphPad Prism software version 8 (GraphPad Software Inc., La Jolla, CA, USA). Values are expressed as the mean ± standard deviation
(SD). Differences between groups were analysed by one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. Kruskal-Wallis test followed by Dunn’s post-hoc test was performed to analyse differences between groups for the histology and immunostaining, DAI and MDI. A value of P < 0.05 was considered to indicate statistical significance.
⦁ Results
⦁ Effect of CSR and CP on colon weight/length ratio, DAI and MDI
As shown in Fig. 1, DSS induced significant colon shortening in UC rats compared to that of the N rats. UC/CSR and, particularly UC/CSR/CP rats exhibited significant decrease in the colon shortening with respect to that of the UC group. Additionally, UC/CP rats demonstrated a strong trend towards a significant decrease in the colon weight/ length ratio compared to that of the UC group.
⦁ Histological examination
Colon sections from the N, CSR or CP groups (Fig. 2a, 2b and 2c, respectively) displayed normal colonic mucosa (arrows) and normal intestinal crypts (arrowheads). As shown in Fig. 2d, colon sections from UC rats displayed inflammatory cell infiltration (arrowheads) and loss of intestinal crypts (arrow). On the other hand, colon sections from the UC/CSR rats (Fig. 2e) revealed diminished crypt degeneration (arrows) and interstitial inflammatory cell infiltration (arrowheads). In addition, colon sections from the UC/CP rats (Fig. 2f) revealed mild ulceration (arrow) and mild interstitial inflammatory cell infiltration (arrowhead), while colon sections from the UC/CSR/CP rats (Fig. 2g) revealed improved colon tissue histologic picture of mild interstitial inflammatory cell infiltration (arrowheads). Moreover, in comparison with the UC rats, the UC/CSR/CP rats exhibited the most significant decrease in the histological score next to the UC/CSR rats (Fig. 2h).
⦁ Effect of CSR and CP on MPO, GSH, SOD and MDA
As depicted in Fig. 3a, the DSS induced increase in the colonic MPO activity, while treatment with CSR and CP or the combination of both reduced the DSS-induced increase in the MPO activity. Notably, the UC/CSR/CP rats exhibited a strong trend for a significant decrease (p= 0.08) in the colonic MPO activity with respect to the UC/CP rats. Increased oxidative stress due to the effect of DSS induced significant consumption of colonic GSH in the UC group colons compared to that of the N group. On the other hand, only the UC/CSR/CP rats show a significant increase in the colonic GSH level compared to that of the UC rats. However, UC/CSR rats show a strong trend towards a significant increase (p= 0.07) in the colonic GSH level compared to that of the UC rats (Fig. 3b). Likewise, the DSS induced significant decrease in the colonic level of SOD in the UC group colons compared to that of the N group. However, the UC/CSR rats and, particularly the UC/CSR/CP rats show a significant increase in the level of colonic SOD with respect to that of the UC rats. Herein, the UC/CP rats did not exhibit a significant change in the colonic level of SOD compared to that of the UC rats. Compared to the UC rats, drug treatment with CSR, CP or the combination of both significantly counteracted the DSS-induced elevation in the lipid peroxidation market MDA. In this regard, the colonic MDA level is significantly decreased in the UC/CSR/CP rats compared to that level in the UC/CP rats (Fig. 3d).
⦁ Effect of CSR and CP on caspase-1 activity
A significant repression of caspase-1 activity is confirmed after treatment with CSR, CP or their combination compared to that in DSS-treated rats. In this regard, we found that this inhibitory effect was significantly amplified with combination therapy compared to CSR monotherapy (Fig. 4).
⦁ Immunohistochemical labelling of caspase-1
Fig. 5 shows the immunolabelling of caspase-1 within colonic sections of rats from the different groups. Caspase-1 was expressed mostly in the intestinal epithelium, glandular epithelium and interstitial inflammatory cells. Scanty expression of caspase-1 was detected within normal groups (Fig. 5a, b, and c). Marked expression of caspase-1 was noticed within the glandular epithelium (arrow) and within the interstitial inflammatory cells (arrowhead) (Fig. 5d). Decreased number of positive cells/1000 counted cells was particularly observed in UC/CP and UC/CSR/CP groups (Fig. 5f and g, respectively), while the DSS-induced rats treated with CSR showed greater number of the positive cells of caspase-1 immunostaining (Fig. 5e). Fig. 5h shows the caspase-1 immunopositive cells/1000 cell count that is expressed as fold change versus that of the normal rats. Herein, we found a significant decrease in that expression in the UC/CSR/CP group with respect to the UC/CSR group. In consistence with the effect of CP on caspase-1 activity (Fig. 4), the immunohistochemical findings can be interpreted based on the potential ability of CP in inhibiting the NLRP3 inflammasome activity.
⦁ Effect of CSR and CP on the levels of TNF-α, IL-6, IL-1β, and IL-18
Colonic levels of TNF-α (Fig. 6a), IL-6 (Fig. 6b), IL-1β (Fig. 6c), and IL-18 (Fig. 6d) were significantly increased in UC rats with respect to the N rats. Rats treated with CSR, CP or the combination of both displayed significant decreases in their levels compared with the UC rats. Remarkably, UC rats treated with a combination of CSR and CP displayed significant decreases in the levels of TNF-α, IL-6, IL-1β, and IL-18 compared to those of the UC/CP rats. In addition, regarding levels of IL-18, the UC/CSR/CP rats displayed significant difference with respect to the UC/CSR rats.
⦁ Effect of CSR and CP on the colonic mRNA and protein expression of HSP-90
Fig. 7a shows that rats treated with DSS had significantly higher colonic mRNA and protein expression of HSP-90 with respect to the N rats. On the other hand, treatment with CSR monotherapy and the dual therapy of CSR and CP significantly attenuated the DSS-induced increase in those levels compared to that of the UC rats. Conversely, treatment with CSR did not show a significant decrease in the colonic mRNA or the protein expression of HSP-90 with respect to DSS-treated rats. Moreover, both the UC/CSR and the UC/CSR/CP rats showed a significant decrease in the levels of the colonic mRNA and protein expression of HSP-90 compared to those of the UC/CP rats. The latter finding can be explained based on the inability of CP to affect the HSP-90 on the mRNA or protein expression levels. Regarding the mRNA expression level of NLRP3, compared to the UC rats, CSR, CP or their dual administration significantly interrupted the DSS-induced elevations. In addition, the mRNA expression level of NLRP3 in the UC/CSR/CP group found significantly reduced in comparison with that of the UC/CSR group. In this regard, CP displayed a greater potential as a repressor of the NLRP3 mRNA expression than CSR.
⦁ Effect of CSR and CP on the p-AMPKα (Ser487)/AMPKα ratio, p-mTOR (Ser2448), BECN1 and p62 SQSTM1
Fig. 8a shows that the DSS-treated group of rats had significantly lower p-AMPKα (Ser487)/AMPKα ratio with respect to the N rats. This ratio was increased, although not significant, after treatment with CSR or CP. Interestingly, only the dual administration of CSR and CP significantly resulted in an increased p-AMPKα (Ser487)/AMPKα ratio with respect to that of the UC rats. This finding confirm the existence of a significant synergistic activity between CSR and CP in the activation of AMPK pathway and that activation of AMPK signalling is implicated in the coloprotective effect of this combination through inducing autophagy. A result that can be confirmed by investigating mTOR signalling and
autophagy proteins during the course of DSS-induced intestinal injury. In this regard, we determined the levels of p-mTOR (Ser2448) and found that treatment with CP did not significantly affect its levels in comparison with that of the UC rats and that the treatment with CSR and the combination of CSR and CP resulted in a significant decrease in the levels of p-mTOR (Ser2448) in comparison with that of the UC rats. A further confirmatory step is established by the determination of autophagy proteins. Likewise, CP did not significantly affect the levels of BECN1 and p62 SQSTM1 in comparison with those of the UC rats and that the treatment with CSR and the combination of CSR and CP resulted in a significant increase in the levels of BECN1 and a significant decrease in the levels of p62 SQSTM1 with respect to those of the UC arts. In addition, UC/CSR/CP rats displayed a strong trend (p= 0.06) towards a significant increase in the BECN1 level and a significant decrease in the p62 SQSTM1 compared to that of the UC/CP rats. These data confirm that CP as a monotherapeutic agent did not induce or interrupt autophagy signalling and that CSR is an autophagy inducer in the ulcerated colon. In addition, CSR augmented the sensitivity of colon tissue to the effect of CP by inducing autophagy. This interesting result can be attributed to the ability of CSR to repress the HSP-90 on the mRNA and protein expression levels. As a result CSR offers novel complementary coloprotective effects to the effect of CP.
⦁ Discussion
Interrupting NLRP3 inflammasome activation is a promising therapeutic approach for the development of new treatments for UC. In the present study, we suggested that targeting both NF-κB and NLRP3 signal ing is a promising avenue for the development of effective therapeutics for human IBDs.
NLRP3 inflammasome activation has been defined as a critical component of the inflammatory process in a diversity of inflammatory diseases such as multiple sclerosis, type
2 diabetes, atherosclerosis and IBDs. This study describes for the first time the potential complementary effects of using CSR and CP in the treatment of UC. The most outstanding findings are that CSR, on the one hand, repressed HSP-90 and, on the other hand, induced autophagy. These two effects might lead to subjecting the NLRP3 to the degradation by autophagy. Therefore, our results collectively suggest that CSR augments the sensitivity of the NLRP3 to the effect of CP. As a result, the severity of the DSS-induced colon injury is significantly reduced after the dual administration of CSR and CP.
The molecular target of CP is not yet defined. However, CP does not suppress NLRP3 activity via inhibiting the inflammasome priming (Coll et al., 2015). On the other hand, CSR effectively inhibits the priming signal in the cascade of NLRP3 inflammasome activation. But, the second signal (activation) is inhibited by CP. Accumulating evidence supports a proinflammatory contribution of NLRP3 to UC pathology. In addition, active colitis and its progression have been correlated to high levels of IL-1β and IL-18 which are strongly correlated to the activation of NLRP3 inflammasome. Incidentally, CP, a NLRP3 inhibitor, has found to inhibit the release of IL-1β and IL-18 in the injured colon. Accordingly, it has been reported that CP acts as an effective therapeutic agent for the treatment of murine UC (Perera et al., 2018). Our results collectively confirm the former data as we found that CP improved the colonic histological picture, inhibited mRNA expression of NLRP3, inhibited activation of colonic caspase-1 as well as the colonic caspase-1 expression. Furthermore, these effects significantly contributed to repressing the release of IL-1β and IL-18. As a result, necroptosis of inflamed colon is curbed. Nevertheless, the in-depth investigations of the mechanistic target of how CP inactivates NLRP3 inflammasome need to be further explored.
In vivo specific targeting of NLRP3 by CP will not result in complete inhibition of IL-1β release because IL-1β maturation can be mediated by a number of different enzymes including serine proteases and caspase-8 (Latz et al., 2013). Therefore, using CSR in the context of CP potentiates the CP inhibitory activity on IL-1β by interrupting NF-κB signalling which leads to repressing the release of the proform of IL-1β. This approach will provide less immunosuppressive effects when compared to biologics such as Canakinumab, a monoclonal antibody targeted at IL-1β, which has been shown clinically to increase the risk of serious infections.
Clinical applications of CP is feasible because CP is a superior potent pharmacological agent of good oral bioavailability (68%), appropriate for chronic administration and has no known adverse reactions (Coll et al., 2015). In contrast, experimental NLRP3 inhibitors for UC are administered parenterally (He et al., 2016). On the other hand, CSR shows poor oral bioavailability (17%) which has been overcome by using different nanoformulations. CSR clinical applications are limited by the adverse reactions reported in animal models. These adverse effects can be minimized by using reduced doses of CSR but efficacy might be interrupted. Therefore, seeking agents of complementary anti-inflammatory potential to CSR is a promising option to overcome such obstacle. Herein, we suggest CP as a promising candidate adjuvant to CSR in the treatment of inflammatory bowel diseases. Alternatively, we also found that CSR augmented the sensitivity of NLRP3 to the effect of CP. In this regard, cost effective doses and lower adverse reactions might be reasonable. However, further studies are required to investigate the effect of lower doses of CSR and CP during the course of intestinal inflammation.
HSP90 and the ubiquitin ligase-associated protein (SGT1) are critical proteins for NLRP3 activation. The interplay of such molecules with NLRP3 is proposed to uphold NLRP3
inactive. Once the activation signals are initiated, HSP90 and SGT1 dissociate from NLRP3, allowing inflammasome oligomerization. Consequently, It has been proposed that pharmacological inhibition of HSP90 can significantly repress inflammasome activity, leading to repression of NLRP3-mediated inflammatory conditions such as gout (Elliott and Sutterwala, 2015). The current study revealed that CSR downregulated both the mRNA and protein expression of HSP-90. Therefore, we suggest CSR as a HSP-90 inhibitor. Herein, combined therapy of CSR with CP might allowed NLRP3 to release from its complex with HSP-90 and subjecting the receptor protein to degradation. In addition, we suggested that this degradation process might be mediated through autophagy activation. Therefore, we investigated autophagy proteins during the course of intestinal injury. In this regard, our results revealed that combined therapy of CSR and CP activated AMPK/mTOR signalling. AMPK directly phosphorylates at least two proteins to induce rapid inhibition of mTORC1 activity. In this context, we proposed that active mTOR indirectly supports colitis by inhibiting autophagy. Accordingly, our results suggest that the combined therapy of CSR and CP induced autophagy via AMPK-dependent mechanisms. A further confirmation was established by detecting levels of autophagy proteins BECN1 and p62 SQSTM1.
Although the combination CSR/CP showed an additive effect in some parameters, it did not show a further improve on colon shortening, DAI, MDI and histological score. However, levels of significance in these parameters are increased dramatically in the CSR/CP group vs UC group compared to those of the CSR or CP group vs UC group. Collectively, the dual administration of CSR and CP increased the antioxidant defense machinery of the colonic tissue and decreased the MPO activity. Furthermore, the inflammation markers such as TNF- α and IL-6 were downregulated. These effects might be attributed to the inhibition of the priming step of the NLRP3 inflammasome by interrupting NF-κB signal ing and inhibition of HSP-90 (at the protein and mRNA levels) by the effect of CSR in addition to the inhibition of
the expression of the NLRP3 by the effect of CP. These latter effects resulted in decreased tissue expression and activity of the caspase-1 and repressing the subsequent release of the active forms of IL-1β and IL-18, hence, the pyroptosis process is restrained. What's more, the CSR/CP combined therapy have resulted in inducing autophagy by AMPK/mTOR-dependent mechanisms leading to the accumulation of BECN1 protein and a significant decrease in the levels of p62 SQSTM1. The inhibitory effect on HSP-90 in conjunction with induction of autophagy suggest increased autophagic degradation of NLRP3. In summary, our results suggest that the CSR/CP combination therapy exerted augmented protective effects on DSS- induced colitis. Therefore, after further investigations, this approach might provide a basis for a clinical application of this combination in IBD treatment as well as pharmacological intervention of other NLRP3 inflammasome-dependent inflammatory conditions.
Author contributions
Conceptualization of this research idea, methodology development, experiments, data collection, data analysis, editing, interpretation and final revision were implemented by S.S.; writing original draft preparation, literature review, interpretation, and analysis were implemented by A.S., E.M.A., R.E. and H.S.; data collection, literature review and analysis were implemented by B.E., A.M. and D.E.
Competing interests
The authors declare no competing interests.
CRediT author statement
Sameh Saber: conceptualization of this research idea, methodology development, experiments, data collection, investigation, validation, resources, project administration, writing-review & editing. Eman M. Abd El-Kader: methodology development, data collection, writing-review & editing. Hossam Sharaf: methodology development, data collection, writing-review & editing. Rewan El-Shamy: methodology development, data collection, writing-review & editing. Baraah El-Saeed: methodology development, data collection,
writing-review & editing. Asmaa Mostafa: methodology development, data collection, writing-review & editing. Dalia Ezzat: methodology development, data collection, writing-review & editing. Ahmed Shata: methodology development, data collection, writing-review & editing.
Declaration of interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
References:
Agampodi Promoda, P., Dale, K., Rajaraman, E., 2017. NLRP3 Inhibitors as Potential Therapeutic Agents for Treatment of Inflammatory Bowel Disease. Current Pharmaceutical Design 23, 2321-2327.
Coll, R.C., Robertson, A.A., Chae, J.J., Higgins, S.C., Muñoz-Planillo, R., Inserra, M.C., Vetter, I., Dungan, L.S., Monks, B.G., Stutz, A., 2015. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nature medicine 21, 248.
Cooper, H.S., Murthy, S., Shah, R., Sedergran, D., 1993. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Laboratory investigation; a journal of technical methods and pathology 69, 238-249.
Elliott, E.I., Sutterwala, F.S., 2015. Initiation and perpetuation of NLRP 3 inflammasome activation and assembly. Immunological reviews 265, 35-52.
He, X., Wei, Z., Wang, J., Kou, J., Liu, W., Fu, Y., Yang, Z., 2016. Alpinetin attenuates inflammatory responses by suppressing TLR4 and NLRP3 signaling pathways in DSS-induced acute colitis. Scientific reports 6, 28370.
Jagtap, A., Shirke, S., Phadke, A., 2004. Effect of polyherbal formulation on experimental models of inflammatory bowel diseases. Journal of ethnopharmacology 90, 195-204.
Latz, E., Xiao, T.S., Stutz, A., 2013. Activation and regulation of the inflammasomes. Nature Reviews Immunology 13, 397-411.
Perera, A.P., Fernando, R., Shinde, T., Gundamaraju, R., Southam, B., Sohal, S.S., Robertson, A.A., Schroder, K., Kunde, D., Eri, R., 2018. MCC950, a specific small molecule inhibitor of NLRP3 inflammasome attenuates colonic inflammation in spontaneous colitis mice. Scientific reports 8, 1-15.
Saber, S., Basuony, M., Eldin, A.S., 2019a. Telmisartan ameliorates dextran sodium sulfate-induced
colitis in rats by modulating NF-κB signalling in the context of PPARγ agonistic activity. Archives of Biochemistry and Biophysics 671, 185-195.
Saber, S., Ghanim, A.M.H., El-Ahwany, E., El-Kader, E.M.A., 2020. Novel complementary antitumour effects of celastrol and metformin by targeting IκBκB, apoptosis and NLRP3 inflammasome activation in diethylnitrosamine-induced murine hepatocarcinogenesis. Cancer Chemotherapy and Pharmacology 85, 331-343.
Saber, S., Khalil, R.M., Abdo, W.S., Nassif, D., El-Ahwany, E., 2019b. Olmesartan ameliorates chemically-induced ulcerative colitis in rats via modulating NFκB and Nrf-2/HO-1 signaling crosstalk. Toxicology and Applied Pharmacology 364, 120-132.
Fig. 1 Effect of CSR, CP and CSR + CP on (a), colon weight/length ratio; (b), DAI and (c), MDI. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, +++ p < 0.001 vs. N, * p < 0.05 vs. UC, ** p < 0.01 vs. UC, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC.
Fig. 2 Photomicrographs of colon sections from different groups. (a), (b), and (c) colon sections from the N, CSR or CP groups of rats, respectively, show normal colonic mucosa (arrows) and normal intestinal crypts (arrowheads); (d), colon section from UC rats displays inflammatory cell infiltration (arrowheads) and loss of intestinal crypts (arrow); (e), colon section from the UC/CSR group of rats shows diminished crypt degeneration (arrows) and interstitial inflammatory cell infiltration (arrowheads); (f), colon section from the UC/CP group of rats shows mild ulceration (arrow) and mild interstitial inflammatory cell infiltration (arrowhead); (g), colon section from the UC/CSR/CP group of rats shows improved colon tissue histologic picture of mild interstitial inflammatory cell infiltration (arrowheads). As depicted in (Fig. 2h), the UC rat colons have the highest histological score. In addition, the UC/CSR/CP rats display the most significant decrease in the histological score with respect to that of the UC rat colons. H&E stain, X 200, bar = 100 µm. Data are expressed as the mean
± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, ** p < 0.01 vs. UC, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC.
Fig. 3 Effect of CSR, CP and CSR + CP on (a), MPO; (b), GSH; (c), SOD; (d) MDA. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, + p < 0.05 vs. N, ++ p < 0.01 vs. N, +++ p < 0.001 vs. N, ++++ p < 0.0001 vs. N, * p < 0.05 vs. UC, ** p < 0.01 vs. UC, **** p < 0.0001 vs.
UC, # p < 0.05 vs. UC/CP, ### p < 0.001 vs. UC/CP
Fig. 4 Effect of CSR, CP and CSR + CP on caspase-1 activity. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by
Tukey's post-test, ++ p < 0.01 vs. N, +++ p < 0.001 vs. N, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC, @ p < 0.05 vs. UC/CSR.
Fig. 5 Photomicrographs of colon sections from different groups. (a), colon section from the N group of rats shows mild expression of caspase-1 in both the glandular epithelium (arrow) and the interstitial tissues (arrowhead); (b), colon section from the CSR group of rats shows mild expression of caspase-1 within the lining of the intestinal glands (arrow) and the interstitial tissues (arrowheads); (c), colon section from the CP group of rats shows mild expression of caspase-1 within the lining of the intestinal glands (arrow) and the interstitial tissues (arrowheads); (d), colon section from the UC group of rats shows marked expression of caspase-1 within the glandular epithelium (arrow) and within the interstitial inflammatory cells (arrowhead); (e), colon section from the UC/CSR group of rats shows decreased expression of caspase-1 either within the epithelial lining of the intestinal crypts (arrow) and within the inflammatory cells (arrowheads); (f), colon section from the UC/CP group of rats shows mild expression of caspase-1 either within epithelial lining of the intestinal glands (arrows) and within the interstitial tissues (arrowheads); (g), colon section from the UC/CSR/CP group of rats shows marked decrease in caspase-1 expression within epithelial lining of the intestinal glands (arrow) and within the interstitial tissues (arrowheads). As depicted in (Fig. 5h), the UC rat colons have the highest expression level of caspase-1. In addition, the UC/CSR/CP rats display the most significant decrease in the expression level of caspase-1 with respect to that of the UC rat colons. Moreover, the UC/CSR/CP colonic sections display significant decrease in the expression level of caspase-1 compared to the UC/CSR colonic sections. Caspase-1 IHC, bar = 100 µm. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, ++ p < 0.01 vs. N, ++++ p < 0.0001 vs. N, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC.
Fig. 6 Effect of CSR, CP and CSR + CP on (a), TNF-α; (b), IL-6; (c), IL-1β; (d), IL-18. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, + p < 0.05 vs. N, ++ p < 0.01 vs. N, +++ p < 0.001 vs. N, ++++ p < 0.0001 vs. N, * p < 0.05 vs. UC, ** p < 0.01 vs. UC, *** p < 0.001 vs. UC,
**** p < 0.0001 vs. UC, @@@@ p < 0.0001 vs. UC/CSR, # p < 0.05 vs. UC/CP, ## p <
0.01 vs. UC/CP.
Fig. 7 Effect of CSR, CP and CSR + CP on (a), HSP-90 mRNA; (b), HSP-90 and (c), NLRP3 mRNA. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, + p < 0.05 vs. N, +++ p < 0.001 vs. N, ++++ p < 0.0001 vs. N, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC, @ p < 0.05 vs. UC/CSR, ### p < 0.001 vs. UC/CP, #### p < 0.0001 vs. UC/CP, $ p < 0.05 UC/CP vs UC/CSR, $$$ p < 0.001 UC/CP vs UC/CSR.
Fig. 8 Effect of CSR, CP and CSR + CP on (a), p-AMPK (Ser487)/AMPK ratio; (b), m-TOR (S2448); (c), BECN1; (d), p62 SQSTM1. Data are expressed as the mean ± SD. Statistical analysis was performed using ordinary one-way ANOVA, followed by Tukey's post-test, + p
< 0.05 vs. N, ++ p < 0.01 vs. N, +++ p < 0.001 vs. N, ++++ p < 0.0001 vs. N, * p < 0.05 vs.
UC, ** p < 0.01 vs. UC, *** p < 0.001 vs. UC, **** p < 0.0001 vs. UC, # p < 0.05 vs. UC/CP, ## p < 0.01 vs. UC/CP, ### p < 0.001 vs. UC/CP.
Table 1 Primer sequences for qPCR
Primer F R
NLRP3 5′- 5′-
HSP-90 5′- 5′- TTGGGTCTGGGTTTCCTCAGGC-
GAPD 5′- TCAAGAAGGTGGTGAAGCAG 5′- AGGTGGAAGAATGGGAGTTG -
Graphical abstract:
Highlights
⦁ Celastrol augmented sensitivity of NLRP3 to the effect of CP-456773
⦁ Celastrol inhibited HSP-90 and subjected NLRP3 to autophagic degradation
⦁ Celastrol/CP-456773 induced autophagy by AMPK/mTOR mediated mechanism
⦁ Celastrol/CP-456773 downregulated p62 and upregulated BECN1 proteins
⦁ Celastrol/CP-456773 decreased TNF-α, IL-6, IL-1β, IL-18 and protected from colitis